|
|
||||||||
Department of Microbiology and Immunology, University of Rochester Medical Center, Rochester, NY 14642, USA
Correspondence
Birgit Bradel-Tretheway
Birgit_BradelTretheway{at}urmc.rochester.edu
| ABSTRACT |
|---|
|
|
|---|
Published online ahead of print on 11 September 2008 as DOI 10.1099/vir.0.2008/006254-0.
A supplementary figure is available with the online version of this paper.
| INTRODUCTION |
|---|
|
|
|---|
It has been shown that amino acid residue 627 in PB2 is one of the main determinants for cold sensitivity of the avian IAV and for viral pathogenicity in mammalian hosts (Hatta et al., 2007
; Massin et al., 2001
; Murakami et al., 1988
; Torreira et al., 2007
): the presence of lysine at position 627 (K627), instead of the glutamic acid (E627) that is found in avian viruses, is crucial for high virulence in mice (Hatta et al., 2001
). This amino acid does not determine the cell tropism of the virus (Shinya et al., 2004
), but instead enhances viral growth in mice and probably in humans (Hatta et al., 2007
; Salomon et al., 2006
). The mechanism underlying this observation still needs to be elucidated.
Most studies on temperature sensitivity of IAVs have been performed at the level of viral transcription-replication. We were interested in how different temperatures directly affect viral RNA polymerase activity at the transcriptional level. To do this, we elected to use two well-characterized IAVs: (i) the mouse-adapted A/WSN/33 H1N1 virus (WSN) and (ii) the A/Viet/1203/04 H5N1 virus (VN1203). WSN has been described to replicate with about tenfold lower efficiency at 39.5 °C compared with 34 °C, as measured by plaque assay (Kawaguchi et al., 2005
). In contrast, the VN1203 virus has been shown to replicate efficiently at both low (34 °C) and high temperatures (41 °C) (Hatta et al., 2007
).
We purified 3P complexes (PA/PB1/PB2) from the VN1203 (H/H/H) and WSN (W/W/W) strains and compared the effect of temperature on cap-independent and cap-dependent transcription. In addition, we exchanged the PB2 subunits between these two complexes (H/H/W, W/W/H) or substituted the PB2 subunit with an avian subunit from the A/chicken/Nanchang/3-120/01 strain (H3N2) (W/W/N). We developed an adenoviral expression system which is attractive, because recombinant adenoviruses can enter a broad range of cells, including IAV-susceptible human lung epithelial cells (A549). As a result, it is possible to prepare authentic IAV polymerase complexes that contain associated host cell factors that participate in complex formation and/or polymerase function. Using this approach, we show here that PB2 directly affects the temperature optimum for IAV transcription, and that incorporation of an H5N1 or avian PB2 subunit into the IAV 3P complex results in greatly increased polymerase activity at elevated temperatures characteristic of birds. We also show that this effect of the H5N1 and avian PB2 subunits does not depend on the presence of a glutamic acid residue at position 627 of PB2. Finally, our results suggest that PB2 may exert its effect on the temperature optimum of the IAV RNA polymerase by influencing the functional stability of this trimeric protein complex.
| METHODS |
|---|
|
|
|---|
PA from the WSN and the VN1203 strain were tagged at the C terminus with a tandem-affinity purification (TAP)-tag. The TAP-tag was constructed by overlapping PCR-mutagenesis, resulting in a C-terminal TAP where the thrombin cleavage site was followed by a 6xHis tag, a tobacco etch virus (TEV) cleavage site and an IgG-binding domain (protein A domain). Briefly, the ZZ domain of BG1766 (Malkowski et al., 2007
) was amplified by overlapping PCR introducing a TEV cleavage site. The amplified PCR product was ligated at the 5'-terminal EcoRV site to a dsDNA fragment (TCTAGACTGGTGCCGCGCGGCAGCCATCATCATCACCATCATGATATC) containing a thrombin site and a 6xHis tag. WSN or VN1203 PA were fused at their C terminus to the TAP-tag.
Human embryonic kidney (HEK293A or QBI-HEK 293CymR) or human lung endothelial cells (A549) were grown at 37 °C and maintained in DMEM supplemented with 10 % fetal bovine serum, 50 IU penicillin ml–1, 50 µg streptomycin ml–1 and 2 mM glutamine.
Adenovirus production.
Recombinant adenoviruses expressing either LacZ or PB2 from the Nanchang strain (N or NE627K) or PA-TAP, PB1 or PB2 from the WSN or the VN1203 strain were created from pShCMV by homologous recombination into AdEasy and propagation in HEK293A cells (AdEasy system, Stratagene). Only the adenovirus expressing PB2 from the VN1203 strain was constructed differently, by cloning PB2 into the pAdenoVator-CMV(CuO) plasmid followed by recombination into AdEasy and propagation in QBI-HEK 293CymR cells (Qbiogene). The viruses were purified by CsCl density-gradient centrifugation and dialysis. Viral titres were determined by quantitative real-time PCR (Heim et al., 2003
).
Polymerase purification.
A549 cells (6x106 in a T-225 flask) were transduced the following day with each of the three adenoviruses (rAd5-PB1, -PB2, -PA-TAP) at an m.o.i. of 1000 (80 % transduction efficiency); for adenoviruses expressing the codon-optimized genes PA, PB1 and PB2 from the VN1203 (H5N1) strain an m.o.i. of about 100 was used.
Nuclear and cytoplasmic extracts were prepared 48 h post-infection (Nuclear Extract kit, Active Motif) and purified using the TAP method (described below).
Lysates from whole cells were prepared 48 h post-infection in 3 ml ice-cold 1x RIPA buffer (Upstate) supplemented with 1 mM NaF, 1 mM PMSF, 1 mM NaVO3, 1 µl Protease Inhibitor Cocktail (P8340, Sigma).
Poly-Prep Chromatography Columns (0.8x4 cm, Bio-Rad) were loaded with 300 µl IgG Sepharose 6 fast flow bead suspension (Amersham) and washed with IPP-150 buffer (Puig et al., 2001
). Pre-cleared cell lysate (3 ml, corresponding to cells from one 225 cm2 flask) was mixed with 7 ml IPP-150 buffer and rotated for 2–4 h at 4 °C in the presence of IgG. The columns were washed with IPP-150 then with TEV-cleavage buffer (IPP-150 supplemented with 1 mM DTT and 0.5 mM EDTA). The beads were transferred to Micro Bio-Spin Chromatography columns (Bio-Rad) and incubated at 4 °C overnight in 300 µl TEV buffer containing TEV-enzyme (30 U). The eluate was collected by low speed centrifugation and dialysed (50 mM Tris-Cl (pH 7.5), 1 mM EDTA, 200 mM NaCl, 10 % glycerol, 1 mM DTT) using a 20 000 MWCO Dialysis Cartridge (Pierce).
Silver staining and immunoblotting.
Proteins were heat-denatured and separated by 7.5 % SDS-PAGE prior to immunoblotting. For silver staining, gels were treated according to the manufacturer's protocol (SilverXpress Silver Staining kit, Invitrogen).
Antibodies used were (Santa Cruz): anti-
-tubulin (mouse, TU-02), anti-PB1 (vK-20), anti-PB2 (vN-19), anti-actin (H-196) and anti-goat IgG HRP (Sc-2033). ECL anti-rabbit IgG HRP (NA934V) and ECL anti-mouse IgG HRP (NA931V) were purchased from Amersham and anti-Penta-His (mouse) from Qiagen.
ApG- and globin-primed transcription assay.
The ApG-primed transcription assay was performed basically as described elsewhere (Fodor et al., 2002
). The amount of purified 3P complex used in transcription assays was normalized either in terms of PB2 content (as measured by immunoblotting) or in terms of transcriptional activity at 30 °C. IgG-purified, normalized samples were mixed with transcription buffer (25 mM Tris-Cl, pH 7.5, 100 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 2 mM DTT, 0.25 Nonidet P-40, 12.5 % glycerol) supplemented with 0.25 U RNasin µl–1, 1 mM each ATP/ UTP/CTP, 0.1 µM GTP, 0.15 µM [
-32P]GTP (3000 Ci mmol–1), 1.6 µM each 5'- (5'-AGUAGAAACAAGGCC-3') and 3'-end vRNA (5'-GGCCUGCUUUUGCU-3') and 0.3 mM ApG (Biosynthesis). The reaction volume (5 µl) contained 2 µl normalized protein sample. Transcription was allowed to occur for 1 h at 30, 34, 37, 39 or 42 °C and the reaction was terminated by the addition of 4 µl Stop-buffer (10 mM EDTA pH 8.0, 90 % formamide). Transcription products were separated by 18 % PAGE in 7 M urea and detected by autoradiography using a PhosphorImager (Molecular Dynamics). Densitometry was performed using OptiQuant (Version 3.10, Packard Instrument).
The globin-primed (cap-dependent) transcription assay was performed similarly. Instead of ApG rabbit-globin mRNA (Sigma) was used as a cap-donor (10 ng per 5 µl reaction volume) and the incubation time was 90 min (Hara et al., 2006
).
Thermo-stability assay.
Equivalent amounts of polymerase in 2 µl (as determined by polymerase activity at 30 °C) were pre-incubated at 30 °C for 5, 10, 15, 20, 25, 30, 60 and 120 min. After pre-incubation 3 µl ApG-containing transcription buffer, supplemented as described above, was added to the sample and transcription was allowed to occur at 30 °C for 1 h.
| RESULTS |
|---|
|
|
|---|
To confirm the effectiveness of our subcellular fractionation method, we also examined the presence of
-tubulin and actin (both cytoplasmic proteins), and of RanBP5 (which is found predominantly in the cytoplasm, but also in the nucleus) (Deane et al., 1997
). As shown in Fig. 1(a)
, nuclear fractions were lacking in both
-tubulin and actin, but contained RanBP5. Fig. 1(a)
also shows that PA, when expressed alone, mainly accumulated in the cytoplasm with less than 10 % in the nucleus; in contrast, when co-expressed with PB1 and PB2 (W/W/W), PA was readily detected in the nucleus (about 30 %), as expected (Fodor & Smith, 2004
; Nieto et al., 1992
). Thus, the adenovirus expression system had no detectable effect on the expected subcellular localization of the IAV 3P complex and its individual component proteins.
|
We next tested the transcriptional activity of the purified polymerase complexes using an ApG-primed transcription assay in which the 3'- and 5'-vRNA and the dinucleotide ApG were provided. In this assay, the 3P complex initiates extension of the bound dinucleotide; the fully extended product of this reaction is a 14 nt RNA fragment. No extension products were detected when the ApG-primed transcriptional assay was performed with IgG-purified extracts from cells expressing LacZ or PA alone. Only the fully assembled trimeric polymerase complex (W/W/W) generated an extension product (Fig. 1c
). We did not observe any difference in transcriptional activity of purified polymerase complexes from total cell lysates, or from either nuclear or cytoplasmic extracts (Fig. 1c
); the apparently lower transcriptional activity of the nuclear polymerase complex can be attributed simply to the lower amount (
30 % less) of assembled 3P complex present in the nucleus (Fig. 1b
). For further biochemical studies, 3P complexes were isolated in larger quantities from total cell lysates and analysed by silver staining (Fig. 1d
, top panel). The most abundant protein in the purified complex was PA, which was precipitated as a monomer, or complexed with either PB1 (PA/PB1) or PB1 and PB2 (PA/PB1/PB2). The second most abundant protein was PB1, which was pulled down as a dimeric (PA/PB1) or trimeric (PA/PB1/PB2) complex. The presence of dimeric (PA/PB1) complex can be inferred by the presence of the host-factor RanBP5 (Fig. 1d
, bottom panel; Supplementary Fig. S1, available in JGV Online) that is known to interact with PB1 or PB1/PA (Deng et al., 2006
). PB2 was the least abundant protein since it was only precipitated in the context of the intact 3P complex (PA/PB1/PB2); therefore in our future experiments, PB2 content was used to normalize overall levels of the intact 3P complex (unless otherwise indicated). For all following experiments 3P complexes purified from total cellular lysates were utilized.
The 3P complex from the A/Viet/1203/04 (VN1203) strain is highly active, and both the WSN and VN1203 complexes are competent for cap-independent and cap-dependent transcription
We purified 3P complexes (PA/PB1/PB2) from the VN1203 (H5N1) (H/H/H) and the A/WSN/33 (H1N1) (W/W/W) strains as well as complexes in which the PB2 subunits were exchanged (H/H/W, W/W/H) or omitted (H/H). The purified complexes were analysed by silver staining and immunoblotting against PB2 (Fig. 2a
top and bottom panel, respectively). All complexes, except the negative control (H/H), were able to initiate transcription at 30 °C in a cap-independent fashion by utilizing ApG as a primer (Fig. 2b
, top panel). A fully extended primer that yielded a 14 nt transcript was detected for all complexes. An additional band above the 14 nt extension product is likely due to some terminal transferase ability of the IAV polymerase.
|
Relative levels of transcriptional activity for the various complexes were measured by normalizing to the levels of PB2 (Fig. 2a
, bottom panel). This analysis revealed that the VN1203 3P complex was 40-fold more active in the ApG-primed (Fig. 2c
) and about 30-fold more active in the cap-primed transcription assay (Fig. 2d
) than the WSN 3P complex, and that the PB2 subunit contributes to this enhanced activity. These findings are consistent with those reported by Taubenberger, who noted that IAV polymerase complexes containing avian subunits have elevated in vitro activity compared with those containing human IAV proteins (Taubenberger et al., 2005
). The biological significance and mechanistic underpinnings of this observation will require further investigation.
The VN1203 polymerase is active at elevated temperatures, and the PB2 subunit is sufficient to confer broad temperature tolerance on the WSN polymerase
The purified polymerase complexes were subjected to the ApG- (Fig. 3a
) or globin-primed (Fig. 3b
) transcription assay. Reactions were run at 30 °C and at a range of temperatures selected on the basis of their physiological relevance to influenza virus replication (34, 37, 39 and 42 °C). In these experiments, the amount of input 3P complex was standardized by using an equivalent amount of functionally active complex, as determined on the basis of transcriptional activity at 30 °C. The WSN complex (W/W/W) extended the ApG primer best at temperatures ranging from 30 to 34 °C; activity was reduced by more than twofold at 37 °C and more than tenfold at elevated temperatures (39–42 °C) (Fig. 3a
). In contrast, the VN1203 complex (H/H/H) extended the primer best at 34–39 °C, and retained 25 % of its activity at elevated temperature (42 °C). Chimeric complexes in which the PB2 subunit was exchanged (H/H/W, W/W/H) exhibited a temperature sensitivity profile similar to that of the WT complexes from which the PB2 subunit was derived – i.e. the H/H/W complex was minimally active at elevated temperatures, while the W/W/H complex retained a high level of functionality at 39–42 °C (Fig. 3a
). In contrast, the presence of excess PA/PB1 heterodimers in the WSN complexes (W/W/W) had no effect on the thermotolerance of the polymerase (Supplementary Fig. S1).
|
Overall, results obtained with the cap-independent and cap-dependent transcription assays were very similar. One minor difference was that, in the ApG-primed transcription assay, we observed a somewhat more pronounced difference in temperature sensitivity between complexes harbouring the WSN PB2 subunit (W/W/W, H/H/W) and complexes containing the VN1203 PB2 protein (H/H/H, W/W/H). Collectively, these results showed that the VN1203 complex is active at a broad range of temperatures, that this property is dependent on the PB2 subunit, and that this phenotype can be transferred to the WSN 3P complex simply by exchanging the PB2 subunit.
An avian PB2 subunit renders a mammalian WSN complex transcriptionally more active
In light of the putative avian origin of H5N1 viruses, such as A/Viet/1203/04, we wondered whether an avian PB2 (H3N2) protein might have similar properties to the human H5N1 PB2 protein. To test this hypothesis, we cloned and expressed the PB2 subunit from the A/chicken/Nanchang/3-120/01 strain. We then purified 3P complexes (PA/PB1/PB2) from the WSN strain as well as complexes in which the PB2 subunit was substituted with an avian PB2 (W/W/N) or a mutated avian PB2 (W/W/NE627K). An E to K mutation in an avian PB2 has been shown to significantly enhance polymerase activity in mammalian cells, as measured in transcription–replication experiments (Labadie et al., 2007
; Massin et al., 2001
). The purified complexes were analysed by silver staining and by immunoblotting against PB2 (Fig. 4a
top and bottom panel, respectively). All complexes were able to initiate transcription at 30 °C in a cap-independent and a cap-dependent fashion (Fig. 4b
top and bottom panel, respectively). Complexes containing the avian PB2 subunit were found to have 20-fold greater activity than the WSN 3P complex in the ApG-primed and 10–20-fold greater activity in the globin-primed transcription assay. Interestingly, in both assays an E627K mutation in the avian PB2 resulted in a slight increase in activity.
|
|
An avian PB2 confers enhanced functional stability on the WSN 3P complex
To investigate the mechanistic basis for the increased thermal tolerance of complexes containing the avian PB2 subunit, we conducted a comparative analysis of the thermostability of the W/W/W and the W/W/N complexes. For this experiment, an equal amount of 3P complexes (as determined by functional activity at 30 °C) was preincubated at 30 °C. This occurred in the absence of any vRNA or nucleosides over different time periods (0–120 min). The transcriptional activity of each complex was then measured (30 °C, 1 h). It has been reported that the WSN 3P complex is heat labile in the absence of vRNA (Brownlee & Sharps, 2002
), which was confirmed by our analysis. For the W/W/W complex we observed an exponential decay in transcriptional activity when pre-incubated at 30 °C (Fig. 6a, b
); the half-life of the complex was estimated at 5–12 min at this temperature (Fig. 6b
). However, the W/W/N complex was very stable over the entire time-period – with a loss of activity of only about 25 % over a 2 h period. These results demonstrate that the avian PB2 subunit confers greater stability on the WSN 3P complex and extends the functional half-life of the complex. While the functional activity of the W/W/W complex rapidly declined during incubation at 30 °C, this could not be attributed to simple physical dissociation of the complex, since it remained intact even in the absence of vRNA (Fig. 6c
).
|
| DISCUSSION |
|---|
|
|
|---|
In this report, we show that the IAV 3P complex can be successfully purified from human lung epithelial cells using an adenoviral system. We analysed the functional activity of IAV polymerase complexes from the WSN (H1N1) and VN1203 (H5N1) strains, as well as chimeric complexes in which the PB2 subunits were exchanged. Our data show that the H5N1 polymerase complex has more robust thermotolerance than its WSN counterpart, which is active over a narrow temperature range (30–34 °C) with a more than 50 % reduced activity at 37 °C. This effect can be attributed to the PB2 subunit, since a simple exchange of this protein was associated with substantial changes in the temperature sensitivity of the polymerase activity. This effect does not depend on the presence of a glutamic acid residue at position 627, since the PB2 subunits from both the VN1203 and the WSN strain harbour a lysine at position 627 (K627). This suggests that additional determinants within PB2 contribute to virus host-range and replication efficiency as well (Gabriel et al., 2005
; Naffakh et al., 2000
; Shinya et al., 2004
).
We also generated complexes in which we substituted the PB2 subunit in the WSN 3P complex with an avian (H3N2) PB2 counterpart. Functional analysis of these complexes revealed that, like the H5N1 PB2 subunit, the avian PB2 subunit also conferred improved thermotolerance on the WSN 3P complex. Associated host-factors could possibly contribute to the functional properties of the purified 3P complex, although future experiments will be needed to address this question.
Our analyses also showed that the E627 residue in the avian PB2 was not required for the enhanced functional activity of the chimeric W/W/N. The E627K mutation in the avian PB2 led to only a slight increase in thermotolerance. Studies that have described the role of PB2 amino acid residue 627 as a determinant of cold sensitivity of avian influenza viruses were performed using transcription–replication experiments (Labadie et al., 2007
; Massin et al., 2001
) or by studying the replication of infectious, recombinant viruses (Hatta et al., 2007
; Salomon et al., 2006
). These assays effectively examine both RNA transcription and genome replication, since a defect in either process would lead to a reduction in measured overall replication. In contrast, our experiments examined only viral transcription. Since viral transcription and replication occur via distinct mechanisms, our findings suggest that PB2 residues other than amino acid 627 may regulate temperature sensitivity of viral transcription – and that mutations at these residues may contribute to virus-host adaptation and temperature sensitivity of overall virus replication, through effects on RNA transcription (Chen et al., 2006
; Finkelstein et al., 2007
). Further studies to address this hypothesis are ongoing.
At the mechanistic level, our results show that the thermotolerance-enhancing activity of the avian PB2 can be attributed to an increase in functional stability of the polymerase complex. Brownlee & Sharps (2002)
have speculated that, in the absence of the vRNA promoter, the WSN polymerase complex is open and labile to heat inactivation. We showed that the half-life of the WSN complex in the absence of vRNA was roughly 10 min at 30 °C, whereas the functional half-life of the W/W/N complex exceeded 2 h. The short functional half-life of the WSN complex was not due to disintegration or disassembly of the tripartite polymerase protein complex, since the complex remained intact for at least 1 h.
Our findings support the earlier hypothesis (Brownlee & Sharps, 2002
) that avian IAV RNA polymerases may have increased heat stability, due to the need of avian viruses to replicate at elevated temperatures present in birds. Brownlee also hypothesized that highly pathogenic human influenza viruses may possess polymerases with increased thermostability, relative to less pathogenic strains. Our results provide support for both of these predictions, and suggest the need to examine the thermostability of RNA polymerases from additional viruses.
In conclusion, the results reported in this paper define a new and previously unappreciated role for the influenza PB2 protein in determining the thermostability of the virus RNA polymerase. Future studies will determine the specific amino acid residues that contribute to this property, and will assess whether increased thermostability is associated with greater pathogenicity and/or host adaptation by emerging influenza viruses.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Brownlee, G. G. & Sharps, J. L. (2002). The RNA polymerase of influenza A virus is stabilized by interaction with its viral RNA promoter. J Virol 76, 7103–7113.
Carr, S. M., Carnero, E., Garcia-Sastre, A., Brownlee, G. G. & Fodor, E. (2006). Characterization of a mitochondrial-targeting signal in the PB2 protein of influenza viruses. Virology 344, 492–508.[CrossRef][Medline]
Chen, G. W., Chang, S. C., Mok, C. K., Lo, Y. L., Kung, Y. N., Huang, J. H., Shih, Y. H., Wang, J. Y., Chiang, C. & other authors (2006). Genomic signatures of human versus avian influenza A viruses. Emerg Infect Dis 12, 1353–1360.[Medline]
Claas, E. C., Osterhaus, A. D., van Beek, R., De Jong, J. C., Rimmelzwaan, G. F., Senne, D. A., Krauss, S., Shortridge, K. F. & Webster, R. G. (1998). Human influenza A H5N1 virus related to a highly pathogenic avian influenza virus. Lancet 351, 472–477.[CrossRef][Medline]
Deane, R., Schafer, W., Zimmermann, H. P., Mueller, L., Gorlich, D., Prehn, S., Ponstingl, H. & Bischoff, F. R. (1997). Ran-binding protein 5 (RanBP5) is related to the nuclear transport factor importin-β but interacts differently with RanBP1. Mol Cell Biol 17, 5087–5096.[Abstract]
Deng, T., Sharps, J., Fodor, E. & Brownlee, G. G. (2005). In vitro assembly of PB2 with a PB1-PA dimer supports a new model of assembly of influenza A virus polymerase subunits into a functional trimeric complex. J Virol 79, 8669–8674.
Deng, T., Engelhardt, O. G., Thomas, B., Akoulitchev, A. V., Brownlee, G. G. & Fodor, E. (2006). Role of Ran binding protein 5 in nuclear import and assembly of the influenza virus RNA polymerase complex. J Virol 80, 11911–11919.
Finkelstein, D. B., Mukatira, S., Mehta, P. K., Obenauer, J. C., Su, X., Webster, R. G. & Naeve, C. W. (2007). Persistent host markers in pandemic and H5N1 influenza viruses. J Virol 81, 10292–10299.
Fodor, E. & Brownlee, G. G. (2002). Influenza virus replication. In Influenza, pp. 1–29. Edited by C. W. Potter. New York, NY: Elsevier Science.
Fodor, E. & Smith, M. (2004). The PA subunit is required for efficient nuclear accumulation of the PB1 subunit of the influenza A virus RNA polymerase complex. J Virol 78, 9144–9153.
Fodor, E., Crow, M., Mingay, L. J., Deng, T., Sharps, J., Fechter, P. & Brownlee, G. G. (2002). A single amino acid mutation in the PA subunit of the influenza virus RNA polymerase inhibits endonucleolytic cleavage of capped RNAs. J Virol 76, 8989–9001.
Gabriel, G., Dauber, B., Wolff, T., Planz, O., Klenk, H. D. & Stech, J. (2005). The viral polymerase mediates adaptation of an avian influenza virus to a mammalian host. Proc Natl Acad Sci U S A 102, 18590–18595.
Gabriel, G., Abram, M., Keiner, B., Wagner, R., Klenk, H. D. & Stech, J. (2007). Differential polymerase activity in avian and mammalian cells determines host range of influenza virus. J Virol 81, 9601–9604.
Gabriel, G., Herwig, A. & Klenk, H. D. (2008). Interaction of polymerase subunit PB2 and NP with importin
1 is a determinant of host range of influenza A virus. PLoS Pathog 4, e11[CrossRef][Medline]
Gambotto, A., Barratt-Boyes, S. M., de Jong, M. D., Neumann, G. & Kawaoka, Y. (2008). Human infection with highly pathogenic H5N1 influenza virus. Lancet 371, 1464–1475.[Medline]
Guilligay, D., Tarendeau, F., Resa-Infante, P., Coloma, R., Crepin, T., Sehr, P., Lewis, J., Ruigrok, R. W., Ortin, J. & other authors (2008). The structural basis for cap binding by influenza virus polymerase subunit PB2. Nat Struct Mol Biol 15, 500–506.[CrossRef][Medline]
Hara, K., Schmidt, F. I., Crow, M. & Brownlee, G. G. (2006). Amino acid residues in the N-terminal region of the PA subunit of influenza A virus RNA polymerase play a critical role in protein stability, endonuclease activity, cap binding, and virion RNA promoter binding. J Virol 80, 7789–7798.
Hatta, M., Gao, P., Halfmann, P. & Kawaoka, Y. (2001). Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293, 1840–1842.
Hatta, M., Hatta, Y., Kim, J. H., Watanabe, S., Shinya, K., Nguyen, T., Lien, P. S., Le, Q. M. & Kawaoka, Y. (2007). Growth of H5N1 influenza A viruses in the upper respiratory tracts of mice. PLoS Pathog 3, e133[CrossRef]
Heim, A., Ebnet, C., Harste, G. & Pring-Akerblom, P. (2003). Rapid and quantitative detection of human adenovirus DNA by real-time PCR. J Med Virol 70, 228–239.[CrossRef][Medline]
Kawaguchi, A., Naito, T. & Nagata, K. (2005). Involvement of influenza virus PA subunit in assembly of functional RNA polymerase complexes. J Virol 79, 732–744.
Labadie, K., Dos Santos Afonso, E., Rameix-Welti, M. A., van der Werf, S. & Naffakh, N. (2007). Host-range determinants on the PB2 protein of influenza A viruses control the interaction between the viral polymerase and nucleoprotein in human cells. Virology 362, 271–282.[CrossRef][Medline]
Lamb, R. A. & Krug, R. M. (2001). Orthomyxoviridae: the viruses and their replication. In Fields Virology, 4th edn, pp. 1487–1531. Edited by D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman & S. E. Strauss. Philadelphia, PA: Lippincott, Williams and Wilkins.
Li, M. L., Rao, P. & Krug, R. M. (2001). The active sites of the influenza cap-dependent endonuclease are on different polymerase subunits. EMBO J 20, 2078–2086.[CrossRef][Medline]
Li, K. S., Guan, Y., Wang, J., Smith, G. J., Xu, K. M., Duan, L., Rahardjo, A. P., Puthavathana, P., Buranathai, C. & other authors (2004). Genesis of a highly pathogenic and potentially pandemic H5N1 influenza virus in eastern Asia. Nature 430, 209–213.[CrossRef][Medline]
Li, Z., Chen, H., Jiao, P., Deng, G., Tian, G., Li, Y., Hoffmann, E., Webster, R. G., Matsuoka, Y. & Yu, K. (2005). Molecular basis of replication of duck H5N1 influenza viruses in a mammalian mouse model. J Virol 79, 12058–12064.
Liu, M., He, S., Walker, D., Zhou, N., Perez, D. R., Mo, B., Li, F., Huang, X., Webster, R. G. & Webby, R. J. (2003). The influenza virus gene pool in a poultry market in South Central China. Virology 305, 267–275.[CrossRef][Medline]
Malkowski, M. G., Quartley, E., Friedman, A. E., Babulski, J., Kon, Y., Wolfley, J., Said, M., Luft, J. R., Phizicky, E. M. & other authors (2007). Blocking S-adenosylmethionine synthesis in yeast allows selenomethionine incorporation and multiwavelength anomalous dispersion phasing. Proc Natl Acad Sci U S A 104, 6678–6683.
Massin, P., van der Werf, S. & Naffakh, N. (2001). Residue 627 of PB2 is a determinant of cold sensitivity in RNA replication of avian influenza viruses. J Virol 75, 5398–5404.
Murakami, Y., Nerome, K., Yoshioka, Y., Mizuno, S. & Oya, A. (1988). Difference in growth behavior of human, swine, equine, and avian influenza viruses at a high temperature. Arch Virol 100, 231–244.[CrossRef][Medline]
Murphy, B. R., Hinshaw, V. S., Sly, D. L., London, W. T., Hosier, N. T., Wood, F. T., Webster, R. G. & Chanock, R. M. (1982a). Virulence of avian influenza A viruses for squirrel monkeys. Infect Immun 37, 1119–1126.
Murphy, B. R., Sly, D. L., Tierney, E. L., Hosier, N. T., Massicot, J. G., London, W. T., Chanock, R. M., Webster, R. G. & Hinshaw, V. S. (1982b). Reassortant virus derived from avian and human influenza A viruses is attenuated and immunogenic in monkeys. Science 218, 1330–1332.
Naffakh, N., Massin, P., Escriou, N., Crescenzo-Chaigne, B. & van der Werf, S. (2000). Genetic analysis of the compatibility between polymerase proteins from human and avian strains of influenza A viruses. J Gen Virol 81, 1283–1291.
Nieto, A., de la Luna, S., Barcena, J., Portela, A., Valcarcel, J., Melero, J. A. & Ortin, J. (1992). Nuclear transport of influenza virus polymerase PA protein. Virus Res 24, 65–75.[CrossRef][Medline]
Perales, B. & Ortin, J. (1997). The influenza A virus PB2 polymerase subunit is required for the replication of viral RNA. J Virol 71, 1381–1385.[Abstract]
Perales, B., Sanz-Ezquerro, J. J., Gastaminza, P., Ortega, J., Santaren, J. F., Ortin, J. & Nieto, A. (2000). The replication activity of influenza virus polymerase is linked to the capacity of the PA subunit to induce proteolysis. J Virol 74, 1307–1312.
Plotch, S. J., Bouloy, M., Ulmanen, I. & Krug, R. M. (1981). A unique cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral RNA transcription. Cell 23, 847–858.[CrossRef][Medline]
Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, M. & Seraphin, B. (2001). The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24, 218–229.[CrossRef][Medline]
Regan, J. F., Liang, Y. & Parslow, T. G. (2006). Defective assembly of influenza A virus due to a mutation in the polymerase subunit PA. J Virol 80, 252–261.
Salomon, R., Franks, J., Govorkova, E. A., Ilyushina, N. A., Yen, H. L., Hulse-Post, D. J., Humberd, J., Trichet, M., Rehg, J. E. & other authors (2006). The polymerase complex genes contribute to the high virulence of the human H5N1 influenza virus isolate A/Vietnam/1203/04. J Exp Med 203, 689–697.
Sanz-Ezquerro, J. J., de la Luna, S., Ortin, J. & Nieto, A. (1995). Individual expression of influenza virus PA protein induces degradation of coexpressed proteins. J Virol 69, 2420–2426.[Abstract]
Shinya, K., Hamm, S., Hatta, M., Ito, H., Ito, T. & Kawaoka, Y. (2004). PB2 amino acid at position 627 affects replicative efficiency, but not cell tropism, of Hong Kong H5N1 influenza A viruses in mice. Virology 320, 258–266.[CrossRef][Medline]
Suzuki, Y., Ito, T., Suzuki, T., Holland, R. E., Jr, Chambers, T. M., Kiso, M., Ishida, H. & Kawaoka, Y. (2000). Sialic acid species as a determinant of the host range of influenza A viruses. J Virol 74, 11825–11831.
Taubenberger, J. K., Reid, A. H., Lourens, R. M., Wang, R., Jin, G. & Fanning, T. G. (2005). Characterization of the 1918 influenza virus polymerase genes. Nature 437, 889–893.[CrossRef][Medline]
Torreira, E., Schoehn, G., Fernandez, Y., Jorba, N., Ruigrok, R. W., Cusack, S., Ortin, J. & Llorca, O. (2007). Three-dimensional model for the isolated recombinant influenza virus polymerase heterotrimer. Nucleic Acids Res 35, 3774–3783.
Received 4 August 2008;
accepted 28 August 2008.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |